Place an order for your academic papers, assignments and study assistance. Our reliable paper writing service and research assignment help online ensures timely delivery of high-quality essays, answers, analysis and presentations, tailored to your specific course needs and requirements.
Posted: February 2nd, 2023
Take a look at Extended Data Figure 3 from Huerta-Sánchez et al (2014). How does this figure emphasize that the Tibetan allele for EPAS1 came from Denisovans? (10 points)
2. You are given the following seven aligned sequences from a single population (variants with respect to the first sequence are shown in bold). Justify whether or not you see any evidence of selection. (20 points)
TGGAGTGTGACCATAGCGAT
TGGAGTTTGACCATAGCCAT
TGGAGTGTGACCATAACCAT
TGGTGTTTGCCCATAACGAT
TGGTGTGTGACCATAGCGAT
TGGTGTGTGCCCATAGCGAT
TGGAGTGTGACCATAACGAT
3. Explain the concept of the “Neutral Theory of Molecular Evolution” and how it relates to the idea of a molecular clock? (10 points)
Extended Data Figure 3 from Huerta-Sánchez et al (2014) shows the distribution of alleles for the gene EPAS1 in various populations. The figure emphasizes that the Tibetan allele for EPAS1 came from Denisovans by showing that this particular allele is found only in Tibetans and Denisovans, and not in any other populations studied. This suggests that the allele was introduced into the Tibetan population through interbreeding with Denisovans.
The seven aligned sequences show evidence of genetic variation within the population, but it is not possible to determine if there is evidence of selection based on this limited data. To determine if selection is occurring, additional information is needed, such as the functional significance of the alleles, the frequency of the alleles in the population, and whether the alleles are associated with any particular traits.
The Neutral Theory of Molecular Evolution posits that most evolutionary changes at the molecular level, such as changes in DNA sequences, are due to neutral processes such as genetic drift and mutation, rather than natural selection. The concept of a molecular clock refers to the idea that the rate of accumulation of mutations in DNA sequences is roughly constant over time, allowing the estimation of evolutionary divergence times between species based on the number of differences in their DNA sequences. The Neutral Theory suggests that this molecular clock reflects the accumulation of neutral mutations, which are not subject to natural selection and therefore evolve randomly over time.
Place an order in 3 easy steps. Takes less than 5 mins.
Each Student Wants High Quality and That’s Our Focus
An online hub of writing bishops' experts. We select the best qualified writers to join our team. These writers are recruited based on their college graduation grades, exceptional writing skills and ability to convey complex ideas in a clear manner. They each have expertise in specific topic fields and background in academic writing. This expertise enables them to provide well-researched and informative content that meets the highest standards.
In appreciation of the fact that our clients are majorly college and university students, we offer the lowest possible pricing while still providing the best writers. This approach ensures that our clients receive high-quality content and best coursework grades without breaking the bank. Our costs are fair and reasonable compared to other custom writing services in the market. As a result of maintaining the balance between affordability and quality, we have established ourselves as a reliable choice in the industry.
You will never receive a final paper that contains any plagiarism or AI use similarity index. Our team of professional writers and editors is dedicated to ensuring the originality of all content. We scan every final draft before releasing it to be delivered to a customer for submission in safeassign and turnitin. This rigorous process guarantees that the work meets the highest standards of academic integrity.